dna sequence electropherograms (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
99
Structured Review
Thermo Fisher
dna sequence electropherograms
Dna Sequence Electropherograms, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+sequence+electropherograms/DNA/pmc04505615-99-2-20
Average 99 stars, based on 1 article reviews
Dna Sequence Electropherograms, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+sequence+electropherograms/DNA/pmc04505615-99-2-20
Average 99 stars, based on 1 article reviews
dna sequence electropherograms - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
Sequencing:Article Title: Multicentric Carpotarsal Osteolysis Syndrome is Caused by Only a Few Domain-Specific Mutations in MAFB , a Negative Regulator of RANKL-Induced Osteoclastogenesis Article Snippet: Twenty DNA samples from healthy Caucasians (Coriell Life Sciences, Camden, NJ) were PCR amplified and sequenced as an experimental control. .. The patients’ Article Title: Role of Oncogenic Pathways and KRAS/BRAF Mutations in the Behavior of Colon Adenocarcinoma in Renal Transplant Patients Article Snippet: Background.. The behavior and mechanisms of colorectal carcinoma in solid organ transplantation have not been well characterized.. Our aim was to determine the clinical and molecular phenotypes of colorectal carcinoma in kidney transplant recipients and compare with those in the nonimmunosuppressed population. Article Title: DOMOIC ACID PRODUCTION By PSEUDO-NITZSCHIA SERIATA (BACILLARIOPHYCEAE) IN SCOTTISH WATERS1 Article Snippet: In 1999, a 49,000km area in western Scottish waters was closed to shellfish harvesting due to the amnesic shellfish poisoning (ASP) toxin domoic acid (DA).. The only previously confirmed DA producer identified had been Pseudo-nitzschia australis Frenguelli.. The toxin has appeared every year since and has led to more harvesting closures. Article Title: The importance of KRAS mutations and EGF61A>G polymorphism to the effect of cetuximab and irinotecan in metastatic colorectal cancer. Article Snippet: PCR products were sequenced in both directions with nested primers (sense primer: 5#- TGTGTGACATGTTCTAATATAGTCACAT and antisense primer: 5#- GGTCCTGCACCAGTAATATGC) by using BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) followed by capillary electrophoresis on an ABI 3130 Genetic Analyzer (Applied Biosystems). .. Mutations were identified by visual inspection of Article Title: Evidence of Genetic Diversity Underlying Rh D−, Weak D (Du), and Partial D Phenotypes as Determined by Multiplex Polymerase Chain Reaction Analysis of the RHD Gene Article Snippet: .. Article Title: Thermodynamic stability and denaturation kinetics of a benign natural transthyretin mutant identified in a Danish kindred. Article Snippet: The disease phenotype of transthyretin (TTR) is dramatically influenced by single point mutations in the TTR gene.. Herein, we report on a novel mutation D99N (Asp99Asn) in TTR found in a Danish kindred.. None of the family members carrying this mutation have so far shown any clinical signs of amyloidosis. Control:Article Title: Multicentric Carpotarsal Osteolysis Syndrome is Caused by Only a Few Domain-Specific Mutations in MAFB , a Negative Regulator of RANKL-Induced Osteoclastogenesis Article Snippet: Twenty DNA samples from healthy Caucasians (Coriell Life Sciences, Camden, NJ) were PCR amplified and sequenced as an experimental control. .. The patients’ Software:Article Title: Multicentric Carpotarsal Osteolysis Syndrome is Caused by Only a Few Domain-Specific Mutations in MAFB , a Negative Regulator of RANKL-Induced Osteoclastogenesis Article Snippet: Twenty DNA samples from healthy Caucasians (Coriell Life Sciences, Camden, NJ) were PCR amplified and sequenced as an experimental control. .. The patients’ Article Title: Role of Oncogenic Pathways and KRAS/BRAF Mutations in the Behavior of Colon Adenocarcinoma in Renal Transplant Patients Article Snippet: Background.. The behavior and mechanisms of colorectal carcinoma in solid organ transplantation have not been well characterized.. Our aim was to determine the clinical and molecular phenotypes of colorectal carcinoma in kidney transplant recipients and compare with those in the nonimmunosuppressed population. Article Title: The importance of KRAS mutations and EGF61A>G polymorphism to the effect of cetuximab and irinotecan in metastatic colorectal cancer. Article Snippet: PCR products were sequenced in both directions with nested primers (sense primer: 5#- TGTGTGACATGTTCTAATATAGTCACAT and antisense primer: 5#- GGTCCTGCACCAGTAATATGC) by using BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) followed by capillary electrophoresis on an ABI 3130 Genetic Analyzer (Applied Biosystems). .. Mutations were identified by visual inspection of Article Title: Thermodynamic stability and denaturation kinetics of a benign natural transthyretin mutant identified in a Danish kindred. Article Snippet: The disease phenotype of transthyretin (TTR) is dramatically influenced by single point mutations in the TTR gene.. Herein, we report on a novel mutation D99N (Asp99Asn) in TTR found in a Danish kindred.. None of the family members carrying this mutation have so far shown any clinical signs of amyloidosis. Generated:Article Title: Role of Oncogenic Pathways and KRAS/BRAF Mutations in the Behavior of Colon Adenocarcinoma in Renal Transplant Patients Article Snippet: Background.. The behavior and mechanisms of colorectal carcinoma in solid organ transplantation have not been well characterized.. Our aim was to determine the clinical and molecular phenotypes of colorectal carcinoma in kidney transplant recipients and compare with those in the nonimmunosuppressed population. Article Title: The importance of KRAS mutations and EGF61A>G polymorphism to the effect of cetuximab and irinotecan in metastatic colorectal cancer. Article Snippet: PCR products were sequenced in both directions with nested primers (sense primer: 5#- TGTGTGACATGTTCTAATATAGTCACAT and antisense primer: 5#- GGTCCTGCACCAGTAATATGC) by using BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) followed by capillary electrophoresis on an ABI 3130 Genetic Analyzer (Applied Biosystems). .. Mutations were identified by visual inspection of Article Title: Thermodynamic stability and denaturation kinetics of a benign natural transthyretin mutant identified in a Danish kindred. Article Snippet: The disease phenotype of transthyretin (TTR) is dramatically influenced by single point mutations in the TTR gene.. Herein, we report on a novel mutation D99N (Asp99Asn) in TTR found in a Danish kindred.. None of the family members carrying this mutation have so far shown any clinical signs of amyloidosis. Derivative Assay:Article Title: DOMOIC ACID PRODUCTION By PSEUDO-NITZSCHIA SERIATA (BACILLARIOPHYCEAE) IN SCOTTISH WATERS1 Article Snippet: In 1999, a 49,000km area in western Scottish waters was closed to shellfish harvesting due to the amnesic shellfish poisoning (ASP) toxin domoic acid (DA).. The only previously confirmed DA producer identified had been Pseudo-nitzschia australis Frenguelli.. The toxin has appeared every year since and has led to more harvesting closures. Comparison:Article Title: DOMOIC ACID PRODUCTION By PSEUDO-NITZSCHIA SERIATA (BACILLARIOPHYCEAE) IN SCOTTISH WATERS1 Article Snippet: In 1999, a 49,000km area in western Scottish waters was closed to shellfish harvesting due to the amnesic shellfish poisoning (ASP) toxin domoic acid (DA).. The only previously confirmed DA producer identified had been Pseudo-nitzschia australis Frenguelli.. The toxin has appeared every year since and has led to more harvesting closures. Process/Product Development:Article Title: The importance of KRAS mutations and EGF61A>G polymorphism to the effect of cetuximab and irinotecan in metastatic colorectal cancer. Article Snippet: PCR products were sequenced in both directions with nested primers (sense primer: 5#- TGTGTGACATGTTCTAATATAGTCACAT and antisense primer: 5#- GGTCCTGCACCAGTAATATGC) by using BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) followed by capillary electrophoresis on an ABI 3130 Genetic Analyzer (Applied Biosystems). .. Mutations were identified by visual inspection of Article Title: Thermodynamic stability and denaturation kinetics of a benign natural transthyretin mutant identified in a Danish kindred. Article Snippet: The disease phenotype of transthyretin (TTR) is dramatically influenced by single point mutations in the TTR gene.. Herein, we report on a novel mutation D99N (Asp99Asn) in TTR found in a Danish kindred.. None of the family members carrying this mutation have so far shown any clinical signs of amyloidosis. |